ID: 901836081_901836089

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 901836081 901836089
Species Human (GRCh38) Human (GRCh38)
Location 1:11925253-11925275 1:11925302-11925324
Sequence CCGCCGCTGGCATGTCCAAGAGC CTGCAGCGCCTTGAGCTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 6, 4: 54} {0: 2, 1: 0, 2: 3, 3: 18, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!