ID: 901836257_901836264

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 901836257 901836264
Species Human (GRCh38) Human (GRCh38)
Location 1:11925982-11926004 1:11926006-11926028
Sequence CCAGCGGTACCACCTCACCGCGC CCCGCAGGCCGCGCCAGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 36} {0: 2, 1: 0, 2: 0, 3: 27, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!