ID: 901843018_901843024

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 901843018 901843024
Species Human (GRCh38) Human (GRCh38)
Location 1:11965518-11965540 1:11965550-11965572
Sequence CCATCTGCTCTCCCTAGACAGCT CCCACCTGCACAACGACCTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 32, 4: 258} {0: 1, 1: 0, 2: 0, 3: 5, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!