ID: 901843018_901843028

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 901843018 901843028
Species Human (GRCh38) Human (GRCh38)
Location 1:11965518-11965540 1:11965554-11965576
Sequence CCATCTGCTCTCCCTAGACAGCT CCTGCACAACGACCTCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 32, 4: 258} {0: 1, 1: 0, 2: 0, 3: 7, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!