ID: 901846932_901846939

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 901846932 901846939
Species Human (GRCh38) Human (GRCh38)
Location 1:11989249-11989271 1:11989288-11989310
Sequence CCCACTTAAGCACTTTGTCACTG TGGCATTTTTGAGCAGCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 120} {0: 1, 1: 0, 2: 0, 3: 23, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!