|
Left Crispr |
Right Crispr |
| Crispr ID |
901847582 |
901847590 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:11993617-11993639
|
1:11993644-11993666
|
| Sequence |
CCCAGCTACTTGGGAGGCTAGGG |
AGAATGGTGTGAACCCCAGGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 99, 1: 4939, 2: 105258, 3: 216358, 4: 260817} |
{0: 18, 1: 377, 2: 450, 3: 646, 4: 1212} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|