|
Left Crispr |
Right Crispr |
Crispr ID |
901847584 |
901847587 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:11993618-11993640
|
1:11993641-11993663
|
Sequence |
CCAGCTACTTGGGAGGCTAGGGC |
AGGAGAATGGTGTGAACCCCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 73, 1: 3837, 2: 91471, 3: 202528, 4: 245534} |
{0: 61, 1: 827, 2: 1004, 3: 1367, 4: 3276} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|