|
Left Crispr |
Right Crispr |
| Crispr ID |
901847584 |
901847596 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:11993618-11993640
|
1:11993671-11993693
|
| Sequence |
CCAGCTACTTGGGAGGCTAGGGC |
GCCTGCAGTGAGCCGAGATCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 73, 1: 3837, 2: 91471, 3: 202528, 4: 245534} |
{0: 18, 1: 507, 2: 1942, 3: 3342, 4: 3629} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|