ID: 901854564_901854569

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 901854564 901854569
Species Human (GRCh38) Human (GRCh38)
Location 1:12036366-12036388 1:12036407-12036429
Sequence CCACTGCACTCCAGCCTGGGCGA CAGAAAAAGAAAAAAGAGGCTGG
Strand - +
Off-target summary {0: 62339, 1: 213994, 2: 245652, 3: 160170, 4: 93749} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!