ID: 901854565_901854569

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 901854565 901854569
Species Human (GRCh38) Human (GRCh38)
Location 1:12036376-12036398 1:12036407-12036429
Sequence CCAGCCTGGGCGACAGAGCGAGA CAGAAAAAGAAAAAAGAGGCTGG
Strand - +
Off-target summary {0: 26768, 1: 89687, 2: 191248, 3: 194442, 4: 151704} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!