ID: 901854566_901854570

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 901854566 901854570
Species Human (GRCh38) Human (GRCh38)
Location 1:12036380-12036402 1:12036408-12036430
Sequence CCTGGGCGACAGAGCGAGACTCC AGAAAAAGAAAAAAGAGGCTGGG
Strand - +
Off-target summary No data {0: 2, 1: 18, 2: 311, 3: 2663, 4: 13994}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!