ID: 901855027_901855038

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 901855027 901855038
Species Human (GRCh38) Human (GRCh38)
Location 1:12039108-12039130 1:12039139-12039161
Sequence CCTTCTTGCCAGTTTCATTAGCA CTGAGGACAGGGAGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 208} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!