ID: 901857483_901857487

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 901857483 901857487
Species Human (GRCh38) Human (GRCh38)
Location 1:12053595-12053617 1:12053617-12053639
Sequence CCAAGGAAACACAAGGTGGGCTG GCTGCTTTGGGGACGTTGTTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!