ID: 901859277_901859282

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 901859277 901859282
Species Human (GRCh38) Human (GRCh38)
Location 1:12063821-12063843 1:12063835-12063857
Sequence CCACAGGTGGGAGGCTGGCTGAA CTGGCTGAAGGGCTAGTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 330} {0: 1, 1: 0, 2: 3, 3: 8, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!