ID: 901862449_901862454

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 901862449 901862454
Species Human (GRCh38) Human (GRCh38)
Location 1:12083357-12083379 1:12083391-12083413
Sequence CCCAGCAGCACTATCATAATAAC ATGTCTATCGAGAGCAGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 104} {0: 1, 1: 0, 2: 0, 3: 4, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!