ID: 901866509_901866515

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 901866509 901866515
Species Human (GRCh38) Human (GRCh38)
Location 1:12110130-12110152 1:12110162-12110184
Sequence CCCAGGAAGCTGCTTCTAAACTG CCCGACTCTCCCTCCTCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 169} {0: 1, 1: 0, 2: 1, 3: 19, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!