ID: 901870001_901870008

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 901870001 901870008
Species Human (GRCh38) Human (GRCh38)
Location 1:12132947-12132969 1:12132997-12133019
Sequence CCATTTTCCAGCTGGGAGGACAG GCTGAGTTTCACCGCCAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 485} {0: 1, 1: 0, 2: 0, 3: 6, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!