ID: 901878321_901878328

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 901878321 901878328
Species Human (GRCh38) Human (GRCh38)
Location 1:12179611-12179633 1:12179654-12179676
Sequence CCCTGCTCACAGTGTGTTCACAG GGCTCCTTGTCTGTAAAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 291} {0: 1, 1: 7, 2: 124, 3: 807, 4: 3019}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!