ID: 901879766_901879781

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 901879766 901879781
Species Human (GRCh38) Human (GRCh38)
Location 1:12186946-12186968 1:12186985-12187007
Sequence CCGGACTGCCAACCCCAGTCTTT ACTCAGGGGCTTGCTCCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 242} {0: 1, 1: 0, 2: 0, 3: 3, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!