ID: 901882902_901882904

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 901882902 901882904
Species Human (GRCh38) Human (GRCh38)
Location 1:12204391-12204413 1:12204404-12204426
Sequence CCACCACATGCTTGGGGCTGTTT GGGGCTGTTTTGAGCACAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 169} {0: 1, 1: 0, 2: 2, 3: 19, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!