ID: 901887002_901887018

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 901887002 901887018
Species Human (GRCh38) Human (GRCh38)
Location 1:12230265-12230287 1:12230304-12230326
Sequence CCCCGTCGTCCGGCCTCGGTCTG CCTGGGCGTCTGCTCCCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48} {0: 1, 1: 0, 2: 2, 3: 29, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!