ID: 901898123_901898131

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 901898123 901898131
Species Human (GRCh38) Human (GRCh38)
Location 1:12332609-12332631 1:12332635-12332657
Sequence CCTGGAGTTGGGTGGGAGAGGGT TGGGAAGGAGGGGAATGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 431} {0: 1, 1: 1, 2: 12, 3: 180, 4: 1952}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!