ID: 901906759_901906769

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 901906759 901906769
Species Human (GRCh38) Human (GRCh38)
Location 1:12419127-12419149 1:12419163-12419185
Sequence CCACCCTCATCCTGGATCTATAT CAGTGATAATACATTTGATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 145} {0: 1, 1: 0, 2: 0, 3: 14, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!