ID: 901911125_901911135

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 901911125 901911135
Species Human (GRCh38) Human (GRCh38)
Location 1:12459112-12459134 1:12459146-12459168
Sequence CCATCAGCTCTCCATATCCACAG CATGGATGGAAAATATTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 29, 4: 267} {0: 1, 1: 7, 2: 18, 3: 61, 4: 321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!