ID: 901926694_901926697

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 901926694 901926697
Species Human (GRCh38) Human (GRCh38)
Location 1:12570748-12570770 1:12570761-12570783
Sequence CCCTGATCAACTAGGGGCTCCTA GGGGCTCCTAGAGACGGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104} {0: 1, 1: 0, 2: 1, 3: 6, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!