ID: 901926694_901926700

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 901926694 901926700
Species Human (GRCh38) Human (GRCh38)
Location 1:12570748-12570770 1:12570784-12570806
Sequence CCCTGATCAACTAGGGGCTCCTA AGCATCTCAGACCCGAGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104} {0: 1, 1: 0, 2: 0, 3: 10, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!