ID: 901934172_901934176

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 901934172 901934176
Species Human (GRCh38) Human (GRCh38)
Location 1:12616655-12616677 1:12616680-12616702
Sequence CCAAACCAAGTACCCTCTCTCGT CTTCAGAGCTGCAGCCGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 67} {0: 1, 1: 0, 2: 1, 3: 28, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!