|
Left Crispr |
Right Crispr |
| Crispr ID |
901940003 |
901940010 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:12654810-12654832
|
1:12654836-12654858
|
| Sequence |
CCTAAGACTAACCTTTGATCATT |
GGGCAAGACGGCCCTCTCCGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 28, 2: 44, 3: 102, 4: 254} |
{0: 1, 1: 0, 2: 3, 3: 11, 4: 87} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|