ID: 901994044_901994046

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 901994044 901994046
Species Human (GRCh38) Human (GRCh38)
Location 1:13136987-13137009 1:13137012-13137034
Sequence CCTTCAGCTGTACGTAGACTGGT GCTTCTGGAGTGACCAGAGCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 1, 4: 54} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!