ID: 902017266_902017274

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 902017266 902017274
Species Human (GRCh38) Human (GRCh38)
Location 1:13318592-13318614 1:13318617-13318639
Sequence CCTTCCGCCGCCTCCCTCTGAGG TCTGATAAAGATGCCTTGTCTGG
Strand - +
Off-target summary {0: 9, 1: 0, 2: 0, 3: 31, 4: 363} {0: 9, 1: 0, 2: 1, 3: 10, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!