ID: 902024081_902024091

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 902024081 902024091
Species Human (GRCh38) Human (GRCh38)
Location 1:13369922-13369944 1:13369968-13369990
Sequence CCACAGGAGCCCAGTGGAAGAGA AGGTCTAGGGACATCAGCTAGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 2, 3: 34, 4: 301} {0: 10, 1: 2, 2: 4, 3: 5, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!