ID: 902024082_902024087

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 902024082 902024087
Species Human (GRCh38) Human (GRCh38)
Location 1:13369931-13369953 1:13369954-13369976
Sequence CCCAGTGGAAGAGATGCCCAAAG AACTGACCTGAGCAAGGTCTAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 25, 4: 236} {0: 3, 1: 0, 2: 7, 3: 16, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!