ID: 902024085_902024092

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 902024085 902024092
Species Human (GRCh38) Human (GRCh38)
Location 1:13369948-13369970 1:13369985-13370007
Sequence CCAAAGAACTGACCTGAGCAAGG CTAGGGCTACCTGCTTTCAGAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 14, 4: 143} {0: 3, 1: 0, 2: 2, 3: 11, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!