ID: 902041658_902041662

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 902041658 902041662
Species Human (GRCh38) Human (GRCh38)
Location 1:13496937-13496959 1:13496951-13496973
Sequence CCAAGTCATGCTGAGACCCAGAG GACCCAGAGGGAGGTCATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 197} {0: 1, 1: 0, 2: 3, 3: 32, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!