|
Left Crispr |
Right Crispr |
| Crispr ID |
902067123 |
902067127 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:13697954-13697976
|
1:13697969-13697991
|
| Sequence |
CCAGAGGGAGCCCGGCCCTGCTG |
CCCTGCTGCCACCTTAATTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 4, 2: 40, 3: 132, 4: 550} |
{0: 1, 1: 19, 2: 165, 3: 696, 4: 1805} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|