ID: 902067455_902067465

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 902067455 902067465
Species Human (GRCh38) Human (GRCh38)
Location 1:13700176-13700198 1:13700206-13700228
Sequence CCGCCCGACGTCACTTCCGACTG GATGGCGGCGGCGCGGCCGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 58, 4: 420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!