ID: 902111010_902111015

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 902111010 902111015
Species Human (GRCh38) Human (GRCh38)
Location 1:14078295-14078317 1:14078328-14078350
Sequence CCCGCTAGATCTAAACTCCATCC GCATCGTGATTGGCAGCAACAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!