ID: 902118558_902118565

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 902118558 902118565
Species Human (GRCh38) Human (GRCh38)
Location 1:14142095-14142117 1:14142125-14142147
Sequence CCTCCCTCCTTCCCTTTTTTTTT TGGCTTGCCTTAAAACCAGATGG
Strand - +
Off-target summary {0: 2, 1: 29, 2: 287, 3: 2104, 4: 11906} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!