ID: 902118561_902118568

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 902118561 902118568
Species Human (GRCh38) Human (GRCh38)
Location 1:14142102-14142124 1:14142132-14142154
Sequence CCTTCCCTTTTTTTTTTTTTTTT CCTTAAAACCAGATGGAGGTAGG
Strand - +
Off-target summary {0: 193, 1: 3190, 2: 20884, 3: 67855, 4: 103482} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!