ID: 902118563_902118568

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 902118563 902118568
Species Human (GRCh38) Human (GRCh38)
Location 1:14142106-14142128 1:14142132-14142154
Sequence CCCTTTTTTTTTTTTTTTTTGGC CCTTAAAACCAGATGGAGGTAGG
Strand - +
Off-target summary {0: 54, 1: 759, 2: 7409, 3: 40592, 4: 47771} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!