ID: 902118564_902118565

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 902118564 902118565
Species Human (GRCh38) Human (GRCh38)
Location 1:14142107-14142129 1:14142125-14142147
Sequence CCTTTTTTTTTTTTTTTTTGGCT TGGCTTGCCTTAAAACCAGATGG
Strand - +
Off-target summary {0: 19, 1: 278, 2: 1810, 3: 33902, 4: 52576} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!