ID: 902125822_902125830

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 902125822 902125830
Species Human (GRCh38) Human (GRCh38)
Location 1:14210125-14210147 1:14210143-14210165
Sequence CCTATAATCCCCACATATCATGA CATGAGAGGGACACAGTGGGAGG
Strand - +
Off-target summary {0: 4, 1: 76, 2: 519, 3: 1488, 4: 3149} {0: 3, 1: 72, 2: 728, 3: 1442, 4: 3188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!