ID: 902147032_902147038

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 902147032 902147038
Species Human (GRCh38) Human (GRCh38)
Location 1:14410765-14410787 1:14410809-14410831
Sequence CCTTGGAGATGAGAGTGGTGTGG CGGCCACCAGAACCCGAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 271} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!