ID: 902154189_902154192

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 902154189 902154192
Species Human (GRCh38) Human (GRCh38)
Location 1:14470623-14470645 1:14470659-14470681
Sequence CCTGCGTAAGTGAGCACCTTTCT TTTACTTTGTTTGCAGGAAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 40, 4: 501}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!