ID: 902173736_902173740

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 902173736 902173740
Species Human (GRCh38) Human (GRCh38)
Location 1:14633729-14633751 1:14633759-14633781
Sequence CCATCCTCTCTCTGAGGATTCAG TGAGGCTCCTACAGTGCCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 407} {0: 1, 1: 0, 2: 1, 3: 16, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!