ID: 902180962_902180969

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 902180962 902180969
Species Human (GRCh38) Human (GRCh38)
Location 1:14688047-14688069 1:14688078-14688100
Sequence CCAGTCATAGTTTGGCTCTACCC GCCCTAGACGTCTCTACTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 60} {0: 1, 1: 0, 2: 0, 3: 7, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!