ID: 902200128_902200136

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 902200128 902200136
Species Human (GRCh38) Human (GRCh38)
Location 1:14827095-14827117 1:14827123-14827145
Sequence CCCTCACCTGGGAAAAGAGAGGG CCCAGTCCTGAGGCATCCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 49, 4: 341} {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!