ID: 902203950_902203963

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 902203950 902203963
Species Human (GRCh38) Human (GRCh38)
Location 1:14853681-14853703 1:14853732-14853754
Sequence CCAGGCTCCAGCTGTGTCTCTTG ACCCAGAATCAGGCTGCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 53, 4: 419} {0: 1, 1: 0, 2: 2, 3: 20, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!