ID: 902209345_902209350

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 902209345 902209350
Species Human (GRCh38) Human (GRCh38)
Location 1:14893535-14893557 1:14893551-14893573
Sequence CCATCTTCCCTTCCTCCACACCC CACACCCTAACCTTGACTGATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 15, 3: 306, 4: 2760} {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!