ID: 902209957_902209964

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 902209957 902209964
Species Human (GRCh38) Human (GRCh38)
Location 1:14897823-14897845 1:14897865-14897887
Sequence CCTCCTGAAAGGCTCTCAGGACC ACCGCTTGCTGAAACTAACCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 193} {0: 1, 1: 0, 2: 0, 3: 4, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!